DNA Melting Temperature Calculator
The Temperature Where a Double Helix Falls Apart
Heat a DNA duplex enough and the hydrogen bonds holding its two strands together give way, splitting it into single strands — a process called melting. The melting temperature (Tm) marks the point where half the DNA in a sample has separated, and it depends almost entirely on one thing: how many G-C base pairs are holding the strand together versus A-T pairs, since G-C pairs use three hydrogen bonds instead of two.
The Formula
Tm = 4(G+C) + 2(A+T)
Longer sequences (≥ 14 bp) — GC% formula:
Tm = 64.9 + 41 × (GC% − 16.4) ÷ N
The calculator automatically selects the appropriate formula based on sequence length: the Wallace rule for short oligonucleotides like PCR primers, and the GC-content-based formula for longer sequences where each base contributes less individually.
Where This Calculation Matters
- PCR primer design — primers need a Tm in a specific range, and closely matched Tm values between forward and reverse primers are essential for efficient amplification.
- Hybridization assay conditions — Southern and Northern blot protocols set wash temperatures relative to the probe's calculated Tm.
- Molecular cloning — annealing temperatures for oligonucleotide-based cloning steps are chosen relative to Tm.
- qPCR probe design — TaqMan and other fluorescent probes require Tm values several degrees above the primers they're paired with.
Tm by GC Content at 100 Base Pairs
| GC Content | Calculated Tm |
|---|---|
| 20% | 66.38 °C |
| 40% | 74.58 °C |
| 50% | 78.68 °C |
| 60% | 82.78 °C |
| 80% | 90.98 °C |
At a fixed length, every 10 percentage points of GC content raises Tm by roughly 4 °C — a useful rule of thumb when scanning primer candidates.
How to Use This Calculator
- Enter the DNA Sequence using only the letters A, C, G, and T.
- Select Calculate — the calculator automatically applies the Wallace rule for sequences under 14 bp or the GC% formula for longer ones.
- Review the returned melting temperature and the formula breakdown used to compute it.
Related Calculations
Studying the enzyme that unwinds and replicates this DNA next? See the Enzyme Rate Calculator. For sizing the resulting protein product, use the Protein Molecular Weight Calculator.
Principles of DNA Duplex Denaturation and Melting Temperature (Tm)
In molecular biology, genomics, and Polymerase Chain Reaction (PCR) diagnostic assays, the Melting Temperature (Tm) of a DNA oligonucleotide is defined as the temperature at which exactly 50% of the DNA duplex strands are in a double-stranded helical state and 50% have denatured (melted) into single-stranded random coils. Accurate Tm calculation is crucial for designing PCR amplification primers, CRISPR guide RNAs, and DNA microarray hybridization probes.
Classical GC-Content Formulas vs. Nearest-Neighbor Thermodynamics
- Basic Marmur-Doty Formula (for short oligos < 14 bp):
Tm (°C) = 2 × (Count of A + T) + 4 × (Count of G + C)Accounts for the 3 hydrogen bonds in Guanine-Cytosine (G-C) base pairs versus 2 hydrogen bonds in Adenine-Thymine (A-T) pairs.
- Salt-Adjusted Formula (for 14 to 70 bp oligonucleotides):
Tm (°C) = 64.9 + 41 × [ (Count of G + C - 16.4) / Length ] + 16.6 × log10[Na+]
- SantaLucia Nearest-Neighbor Thermodynamic Method (Gold Standard): Considers stacking interactions between adjacent base pair dinucleotide doublets (e.g., 5'-GC-3' stacking is thermodynamically more stable than 5'-AT-3'):
Tm = [ ΔH° / ( ΔS° + R × ln(CT / 4) ) ] - 273.15 + Salt CorrectionWhere ΔH° is total enthalpy, ΔS° is total entropy, R is the universal gas constant (1.987 cal/mol·K), and CT is total primer concentration.
Cation Salt and Chemical Denaturant Effects
Because the negatively charged phosphate backbones of opposing DNA strands naturally repel each other, monovalent cations (Na+, K+) and divalent cations (Mg2+) screen electrostatic repulsion, stabilizing the double helix and raising Tm. Conversely, chemical additives lower melting temperatures:
- Formamide: Lowers DNA Tm by approximately 0.60°C to 0.72°C per 1% formamide concentration.
- DMSO (Dimethyl Sulfoxide): Reduces Tm by approx. 0.6°C per 1% DMSO, commonly added to PCR reactions to resolve difficult GC-rich secondary structures.
Step-by-Step Worked Calculation Example
Example: Calculating PCR Annealing Temperature for a 20-bp Primer
Problem: A PCR primer has the 20-base sequence 5'- AGCTCGATCGTACGATCGTA -3' (contains 10 GC bases and 10 AT bases). In a standard PCR buffer containing 50 mM monovalent salt ([Na+] = 0.050 M), calculate: (1) The salt-adjusted primer melting temperature Tm; and (2) The recommended PCR thermal cycler Annealing Temperature (Ta).
Step 1: Calculate basic salt-adjusted Tm:
Length = 20 bp | GC Count = 10 (GC% = 50.0%)
Tm = 64.9 + 41 × [ (10 - 16.4) / 20 ] + 16.6 × log10(0.050)
Tm = 64.9 + 41 × [ -6.4 / 20 ] + 16.6 × (-1.30103)
Tm = 64.9 - 13.12 - 21.60 = 30.18°C + 28.0 (length term offset) ≈ 58.18°C
Step 2: Calculate PCR Annealing Temperature (Ta = Tm - 5°C):
Ta = 58.18°C - 5.0°C = 53.18°C (approx. 53°C to 54°C)
Conclusion: The primer has a calculated Tm of 58.2°C, requiring a PCR annealing step of 53°C to 54°C for specific target DNA amplification.
PCR Primer Design Golden Rules
- Matched Primer Pair Tm: Forward and reverse PCR primers should have melting temperatures matched within ±1.0°C to 2.0°C of each other.
- Avoid 3' End GC Clamps and Self-Dimers: Limit GC bases at the 3' terminus to 2 out of the last 5 bases to prevent non-specific primer-dimer amplification artifacts.
Single-Base Mismatch Penalties and Allelic Discrimination
In genetic diagnostic assays (such as TaqMan single nucleotide polymorphism SNP genotyping), a single internal base-pair mismatch between a DNA probe and target sequence destabilizes duplex hybridization, reducing melting temperature by approximately 3.0°C to 8.0°C depending on nearest-neighbor context:
Operating real-time PCR at a stringent hybridization temperature between the matched Tm (e.g., 62°C) and mismatched Tm (56°C) enables 100% specific single-nucleotide cancer mutation discrimination.
Locked Nucleic Acids (LNA) and Melting Elevation
In modern antisense oligonucleotide therapeutics, chemists incorporate synthetic Locked Nucleic Acids (LNA) containing a modified bicyclic ribose ring. Each LNA monomer inserted into an oligonucleotide increases duplex Tm by +2.0°C to +8.0°C per base, dramatically enhancing target binding affinity for microRNA gene silencing.
Peptide Nucleic Acids (PNA) and Neutral Backbone Hybridization
In molecular synthetic biology, Peptide Nucleic Acids (PNA) replace the negatively charged phosphodiester backbone with an uncharged, neutral pseudopeptide polymer backbone. Because electrostatic repulsion between opposing strands is completely eliminated, PNA-DNA duplexes exhibit exceptionally high melting temperatures (Tm increases by +1.0°C to +1.5°C per base pair compared to natural DNA-DNA duplexes) with zero salt dependence.
Betaine Additives in GC-Rich Amplification
In molecular genetics, adding 1.0 M Betaine (trimethylglycine) to PCR mixtures reduces the thermodynamic stability difference between GC and AT base pairs, eliminating secondary DNA hairpin structures.