PCR Primer Tm Calculator
Getting Primer Annealing Temperature Right
PCR lives or dies on annealing temperature: set it too high and primers won't bind their target at all; set it too low and they bind nonspecifically, producing off-target amplification. The melting temperature (Tm) of a primer — the temperature at which half of its molecules are bound to the template and half are dissociated — is the standard reference point for choosing an annealing temperature, usually a few degrees below Tm.
The Formula
Tm = 2 × (A + T) + 4 × (G + C)
Primers 14 bp and longer (GC Formula):
Tm = 64.9 + 41 × (GC count − 16.4) ÷ Length
The Wallace rule is a quick heuristic suited to very short primers or probes. The GC formula accounts for the fact that G-C base pairs form three hydrogen bonds versus two for A-T, so a primer's GC content and overall length both drive its Tm once it's long enough for that effect to dominate.
Worked Examples
| Sequence | Length | Formula Used | Tm |
|---|---|---|---|
| ATGCGATC | 8 bp | Wallace Rule | 24.00 °C |
| ATGCATGCATGCATGCATGC | 20 bp | GC Formula | 51.78 °C |
Why Primer Tm Matters
- Choosing annealing temperature — most protocols set the PCR annealing step 3–5°C below the primer's Tm as a starting point for optimization.
- Matching a primer pair — forward and reverse primers with mismatched Tm values force a compromise annealing temperature that may be suboptimal for one or both, reducing amplification efficiency.
- Designing new primers — Tm, alongside GC content and secondary structure, is one of the core checks before ordering a custom oligo for PCR, sequencing, or qPCR.
How to Use This Calculator
- Enter the primer sequence using only the letters A, T, G, and C.
- Select Calculate — the calculator automatically applies the Wallace rule for sequences under 14 bp or the GC formula for 14 bp and longer, and reports the base composition and melting temperature.
Related Calculations
Working out the molecular weight of that same oligo? See the DNA Molecular Weight Calculator.